Primers. This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details. pFastBac-VP1 was prepared by amplifying VP1 from the original vector (forward Comments for pFastBacTM Dual 5238 nucleotides f1 origin: bases 102-557 Ampicillin resistance gene: bases 689-1549 pUC origin: bases 1694-2367 Tn7R: bases 2611-2835 Gentamicin resistance gene: bases 2902-3435 (complementary strand) HSV tk polyadenylation signal: bases 3992-4274 (complementary strand) Multiple cloning site: bases 4274-4337 (complementary strand) p10 promoter … Basic Cloning Vectors; CRISPR Plasmids; Fluorescent Protein Genes & Plasmids; Gateway ® Cloning Vectors; I.M.A.G.E. Reverse transcription (RT) and PCR were … Map of pFastBac ™/NT-TOPO® ... Primer Sequence Polyhedrin forward primer . The Biodesign Institute/Arizona State University. This plasmid is available through Addgene. The primer that anneals with the antisense strand or the noncoding strand or the template strand is known as forward primer since forward primer acts as a starting point to the synthesis of coding or the positive strand of the gene. Search. Sequiserve can provide more than 1000 primers suitable for most known vectors, which enables us to sequence your insert immediately and without further costs.. Quality and functionality of these primers is continuously tested and controlled. LICvBacF - 5'-TACTTCCAATCCAATCG-3' (Note: ATG must be added to ORF) LICv1 Reverse - 5'-TTATCCACTTCCAATGTTATTA-3' As the target plasmid size gets >20kb you may have to increase the amount of DNA you anneal and/or transform. • pFastBac⁄HBM TOPO® Vector containing the C-terminal TEV cleavage sit and His-Tag. Sequence Author: Thermo Fisher (Invitrogen) Download Free Trial Get SnapGene Viewer. Map and Sequence File: Download Open . I extracted the bacmids from white and blue colonies and did the PCR using either M13 Forward and Reverse primers or M13 Forward and gene specific Reverse primers (attached). Forward primer has a short nucleotide sequence that is complementary to the 3’ flanking end of the antisense strand. name: sequence 5’-> 3’ 1049 ggcacagtcgaggctg 1090cmv gtgggaggtctatataa 3aox gcaaatggcattctgacatcc 5aox gactggttccaattgacaagc -96glll ccctcatag ttagcgtaactg : alpha-f tactattgccagcattgctgc : as1b gccagcgccttgtagaagcg : cgfpe ggtcctgctggagttcgtgaccg : as1brev ctatgaccatgattacgc pcr3.1-bghrev tagaaggcacagtcgagg : bgh tagaaggcacagtcgagg : cfr84 … We have found this … Pharmaceutics 2015, 12, 839−845 840. incubation, the spheroids were washed thrice with fresh growth medium, treated with 250-fold diluted mouse monoclonal anti- … 5’-AAATGATAACCATCTCGC-3’ SV40 polyA reverse primer . pFastBac plasmid expression vector (forward primer, 50 AAA GGATCC ACC ATG TTT TCG GTA CAG CGGCC3 0;reverseprimer,5 TTATCTAGATTATTC TGTGTGGAGATGTTC30;BamHIandXbaIsitesare underlined). by the manufacturer (the forward primer contained additional bases CACC to allow for directional cloning). 7(6):561-73. pfastbac forward ggattattcataccgtccca pfastbac reverse caaatgtggtatggctgatt pgex3 ggagctgcatgtgtcagagg pgex5 ggcaagccacgtttggtg pjet1_2f cgactcactatagggagagcgg c custom primers: pjet1_2r aagaacatcgattttccatggca g pmale tcagactgtcgatgaagc pqe-f cccgaaaagtgccacctg pqe-r gttctgaggtcattactgg -fwd gctcgatacaataaacgcc prh forward ctgtctctatactcccctatag prh reverse … Consortium Plasmids; Insect Cell Vectors; pFastBac … Bac-to-Bac ® TOPO ® Cloning and Bac-to-Bac ® TOPO ® Expression System Kits include the control expression plasmid pFastBac ™ Gus, which contains the Gus gene. Plasmid Sets. The digested linear DNA fragment was then ligated with T4 DNA ligase into the multiple cloning site (MCS) … pFastBac-Dual (Invitrogen) was used as the transfer vector for co-expression of VP1 with either wild-type or recombinantly modified VP2. Finally, the membranes were washed four times confirmed by PCR using M13 primers, which resulted in a single 4.7-kb band (about 2.4 kb of the pFastBac HT vector with PBS containing 0.1% Tween 20 and developed by plus 2.3 kb of the hGC). It hybridizes with the antisense strand … Welcome to Vector Database!. 5’-GGTATGGCTGATTATGATC-3’ Gus control plasmid . Sequences. Forward primer: 5´-TTTACTGTTTTCGTAACAGTTTTG-3´ Tm = 62°C. Gene LP1 forward primer . Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This simplifies primer design. Maryland 1330 Piccard Drive Suite 205 Rockville, MD 20850 Tel. M13 Forward (-20) 5'd[GTAAAACGACGGCCAG]3' (16-mer) M13 Forward (-40) 5'd[GTTTTCCCAGTCACGAC]3' (17-mer) M13 Reverse . b The accuracy of recombination ECL kit (Amersham, USA). The findings were then investigated through a 1% agarose gel … 2005 Jun . The following is the list of complimentary Universal Primers offered by our DNA Sequencing facility. Then, the transformation efficiency was verified by PCR while using both specific pFastBac-HTA primers (M13/ pUC) and restriction enzyme digestion analysis. 438-A is an untagged pFastBac LIC Subcloning vector. pFastBac Dual.dna. 2 f–h). 1001 S. McAllister Ave, Tempe, AZ 85287-6401 | Map General Customer Service - Phone: (480) 965-5697 • Email: DNASUHelp@asu.edu Payment Questions - Phone: (480) 965-4544 • Email: DNASUPay@asu.edu Page Contact: DNASU help | Biodesign Institute